| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211486 |
| Chromosome: | chromosome 9 |
| Location: | 428663 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404550 | (1 of 2) 2.7.11.20 - [Elongation factor 2] kinase / EF2K | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGCGGATATGTCCGCAGAGCCAGAACCT |
| Internal bar code: | GGGCAGAGTTTGGAGTCGATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 938 |
| LEAP-Seq percent confirming: | 99.7622 |
| LEAP-Seq n confirming: | 28531 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACGTAGGGGTCTTCACGG |
| Suggested primer 2: | CGCCTCTCCTAGCACGTATC |