| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211486 |
| Chromosome: | chromosome 12 |
| Location: | 5905952 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g534050 | FAP366 | (1 of 1) PTHR10728 - CYTOSOLIC PHOSPHOLIPASE A2; Flagellar Associated Protein 366 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACATGCACAGAGCCTGCCATGCATCCAT |
| Internal bar code: | GTCGCAGTGACCAGGACAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1090 |
| LEAP-Seq percent confirming: | 99.6505 |
| LEAP-Seq n confirming: | 6557 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTGCAGGTCCTAATCGCC |
| Suggested primer 2: | CTCTTTCTCTCCACAACGCC |