Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.211547 |
Chromosome: | chromosome 10 |
Location: | 1201601 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g426292 | PYK6 | (1 of 3) PTHR11817//PTHR11817:SF4 - PYRUVATE KINASE // PYRUVATE KINASE; Pyruvate kinase 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGCTGCCCCGCGCCGCCGCCCGCAGGTG |
Internal bar code: | TTGGACGAGCCAACCGTCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 168 |
LEAP-Seq percent confirming: | 85.0854 |
LEAP-Seq n confirming: | 1295 |
LEAP-Seq n nonconfirming: | 227 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACACACACGCACGCTTACA |
Suggested primer 2: | CACACACACACACGTACCCA |