| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211585 |
| Chromosome: | chromosome 2 |
| Location: | 6687314 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117850 | (1 of 1) K11835 - ubiquitin carboxyl-terminal hydrolase 4/11/15 [EC:3.4.19.12] (USP4_11_15, UBP12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCGCCAGCTACTCGCGCAACAAGCTGGA |
| Internal bar code: | TGGATGCACGAGACGTGGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 303 |
| LEAP-Seq percent confirming: | 80.8173 |
| LEAP-Seq n confirming: | 712 |
| LEAP-Seq n nonconfirming: | 169 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGAGGCGTTATTTTGTTG |
| Suggested primer 2: | ATCCAGATAGGAGCCCAGGT |