| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.211613 |
| Chromosome: | chromosome_10 |
| Location: | 3991785 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre10.g448850 | FAP135,ODA5AK,CAL5 | Calpain cystein protease and Flagellar Associated Protein | sense | CDS |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | CCTGAACGGCGGCTGCCACTACGTCATCAT |
| Internal bar code: | CAGAAGAGAAGTGTGGGCACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1019 |
| LEAP-Seq percent confirming: | 99.716 |
| LEAP-Seq n confirming: | 12989 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACGCACACACAC |
| Suggested primer 2: | ACGTTGCCTCTTGGAGAGAA |