Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.211619 |
Chromosome: | chromosome 16 |
Location: | 1464424 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g652700 | (1 of 41) PTHR10157 - DOPAMINE BETA HYDROXYLASE RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTATTCCTCCTCGCACAGCTGCACCAAA |
Internal bar code: | ACCAGAGTGTAGGGTGGTCAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 800 |
LEAP-Seq percent confirming: | 65.8456 |
LEAP-Seq n confirming: | 1390 |
LEAP-Seq n nonconfirming: | 721 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATACACACGATCACCGCAC |
Suggested primer 2: | TGGAGGAGAGGGGAGGTAGT |