| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211643 |
| Chromosome: | chromosome 6 |
| Location: | 1131225 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257000 | SBP1,SLP3,SULP3 | (1 of 1) K02048 - sulfate transport system substrate-binding protein (cysP, sbp); Sulfate binding protein, component of chloroplast transporter SulP | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAGTGGCTTTGCGTGCAATTGTGCAAAC |
| Internal bar code: | GAATTGGCGCGGGAGTGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 536 |
| LEAP-Seq percent confirming: | 99.5715 |
| LEAP-Seq n confirming: | 8365 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGAGGTGTGATTGGAGC |
| Suggested primer 2: | TGACTGAACCTGCATTCTGC |