| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211652 |
| Chromosome: | chromosome 12 |
| Location: | 5781519 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533300 | SRE2 | Pre-mRNA splicing factor, SR-related; (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGGCGCCAAACGCCTGCAGGTCTGACGC |
| Internal bar code: | GGCCCTTCTGTAGCTACCTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 44 |
| LEAP-Seq percent confirming: | 94.5848 |
| LEAP-Seq n confirming: | 262 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAGGTTTGATCCCGCCTCT |
| Suggested primer 2: | GCTGCTGCTGTTGTTGTTGT |