| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211701 |
| Chromosome: | chromosome 7 |
| Location: | 5408990 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g350250 | (1 of 31) IPR016187 - C-type lectin fold | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCCACTACTCATCCCACCCAAACCTC |
| Internal bar code: | GAGAGAAAGGGAGCCTATCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 717 |
| LEAP-Seq percent confirming: | 96.0744 |
| LEAP-Seq n confirming: | 3255 |
| LEAP-Seq n nonconfirming: | 133 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGTAGGGTAACCACGA |
| Suggested primer 2: | GGGGTTGATTATGTGCGTGT |