| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211704 |
| Chromosome: | chromosome 17 |
| Location: | 4002510 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728950 | RFD2 | diaminohydroxyphosphoribosylaminopyrimidine deaminase; (1 of 1) PTHR11079//PTHR11079:SF76 - CYTOSINE DEAMINASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGCTGCAAGGATTACTGTCCGCAGCAC |
| Internal bar code: | TCGGTGCTTCAGGGAGGGCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1054 |
| LEAP-Seq percent confirming: | 99.2899 |
| LEAP-Seq n confirming: | 7551 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCATGTGCATGTTTGGC |
| Suggested primer 2: | TACCCGCCTCACCATAGAAC |