Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.211707 |
Chromosome: | chromosome 3 |
Location: | 1096733 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g148750 | CLH1 | Chlorophyllase I; (1 of 1) PTHR33428:SF2 - CHLOROPHYLLASE-1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAACCTCGTTTTAGTCTTCTGCCAACC |
Internal bar code: | CACAATGCTACAATTGATTGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1133 |
LEAP-Seq percent confirming: | 99.3594 |
LEAP-Seq n confirming: | 2792 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGCCCTTTTAGGTACGGA |
Suggested primer 2: | TGAGCATCCAGTAAGCAACG |