Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.211752 |
Chromosome: | chromosome 13 |
Location: | 636222 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g565900 | (1 of 2) PF10513 - Enhancer of polycomb-like (EPL1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGAGGCGGCGACTTGGTTGGTGGGCG |
Internal bar code: | AAGCCAGGAGGAAAGAGAAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 816 |
LEAP-Seq percent confirming: | 99.8255 |
LEAP-Seq n confirming: | 9725 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCTAACAACTCGCAACA |
Suggested primer 2: | GCCTCTACCTTTCTCCGCTT |