| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211758 |
| Chromosome: | chromosome 1 |
| Location: | 2045533 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g010950 | (1 of 2) PF00023//PF12796//PF13920 - Ankyrin repeat (Ank) // Ankyrin repeats (3 copies) (Ank_2) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCATCCCTTCGCCACCCCGACCCCAGGCC |
| Internal bar code: | TCGGGACCCCCTCCTGTAATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 697 |
| LEAP-Seq percent confirming: | 99.3151 |
| LEAP-Seq n confirming: | 870 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACCACACACACACG |
| Suggested primer 2: | ATGCGATGAGTGGCTAGCTT |