Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.211814 |
Chromosome: | chromosome 7 |
Location: | 6097293 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g355466 | AGE2 | DNA repair glycosylase; (1 of 1) PF15628 - RRM in Demeter (RRM_DME) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGGCTGATTCAGCAGGGCAGCTGCCCG |
Internal bar code: | GCGTGGTCGCTAGGTTGTCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 555 |
LEAP-Seq percent confirming: | 88.3313 |
LEAP-Seq n confirming: | 9470 |
LEAP-Seq n nonconfirming: | 1251 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTCAACGACTTCCTGACC |
Suggested primer 2: | ACACACACACACGCACACAC |