| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211820 |
| Chromosome: | chromosome 12 |
| Location: | 8975493 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g544000 | RSP5 | (1 of 4) 1.1.1.65 - Pyridoxine 4-dehydrogenase / Pyridoxine dehydrogenase; Radial Spoke Protein 5 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCACCTTGACGTTCTCAAGCTCCGCCT |
| Internal bar code: | CATCCCGGACGCTCTCTCCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1117 |
| LEAP-Seq percent confirming: | 98.2997 |
| LEAP-Seq n confirming: | 5608 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGGTGAGTTCTCGAAGC |
| Suggested primer 2: | GCTCCTTCTCGTACCTGTGC |