| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211911 |
| Chromosome: | chromosome 2 |
| Location: | 2777282 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g094100 | NRX1 | (1 of 3) K17609 - nucleoredoxin [EC:1.8.1.8] (NXN); Nucleoredoxin 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGCAGCAGTGCCCTCCGTGGTGATGAC |
| Internal bar code: | CCGTTTTTTTGATCGGGAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1141 |
| LEAP-Seq percent confirming: | 99.6847 |
| LEAP-Seq n confirming: | 6323 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACTGGGAGGTGGTGTTT |
| Suggested primer 2: | TCGTTCAACTCAACCTTCCC |