| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.211945 |
| Chromosome: | chromosome 14 |
| Location: | 2759741 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g627150 | (1 of 1) PF05670//PF05833 - Domain of unknown function (DUF814) (DUF814) // Fibronectin-binding protein A N-terminus (FbpA) (FbpA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGAGTGCACGGATACCTCATCACAGTT |
| Internal bar code: | TTGACGAGGGCGGCGCTATCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 396 |
| LEAP-Seq percent confirming: | 95.1595 |
| LEAP-Seq n confirming: | 865 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTTACAGGCATGACGAGT |
| Suggested primer 2: | CCAGCTTGCTATGACGTGAA |