| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.211950 |
| Chromosome: | chromosome 13 |
| Location: | 3583748 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588271 | (1 of 1) PF07556 - Protein of unknown function (DUF1538) (DUF1538) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATGGGTTATTGGGCGCGTCGGGAACGGG |
| Internal bar code: | TTCGTCTTTTGTTGAGGCGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 99.614 |
| LEAP-Seq n confirming: | 2839 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCATCTACCATCTTGCC |
| Suggested primer 2: | AGTGGCCTTTCACATTTTGC |