| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.211969 |
| Chromosome: | chromosome 12 |
| Location: | 2656446 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g504250 | (1 of 3) 2.7.11.25//2.7.12.1 - Mitogen-activated protein kinase kinase kinase / MLTK // Dual-specificity kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCAGCGGTATGGGTGCCGGGCGCCGCC |
| Internal bar code: | GTTGACCAATTCGAGTCCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 665 |
| LEAP-Seq percent confirming: | 97.3292 |
| LEAP-Seq n confirming: | 6669 |
| LEAP-Seq n nonconfirming: | 183 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTGAGGTGGATAGCGAG |
| Suggested primer 2: | CAGCAACAGACAGTCCCTGA |