| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.211975 |
| Chromosome: | chromosome 10 |
| Location: | 1308823 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427500 | CYP32,CYP739A1 | (1 of 4) 1.14.13.93 - (+)-abscisic acid 8'-hydroxylase / ABA 8'-hydroxylase; Cytochrome P450, CYP197 superfamily | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAAAACCCGGGACCTACTCCAGGGCTTA |
| Internal bar code: | GTTCGGCTCTTATGGGGATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 99.7824 |
| LEAP-Seq n confirming: | 5502 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGACCTGCTGACGCTAAG |
| Suggested primer 2: | TAATAGGCGCGCTTTCAACT |