| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212014 |
| Chromosome: | chromosome 3 |
| Location: | 2940057 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g163200 | (1 of 1) K15683 - NF-X1-type zinc finger protein NFXL1 (NFXL1, OZFP) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTCCATCACGAGCAGAGCTGCCCCTGG |
| Internal bar code: | CCGAACGCCAAGGGCACTACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 199 |
| LEAP-Seq percent confirming: | 99.5666 |
| LEAP-Seq n confirming: | 8729 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTCTGTCAGAGGCGAGC |
| Suggested primer 2: | GTGTCGTTCCATCACACCTG |