| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.212072 |
| Chromosome: | chromosome 6 |
| Location: | 1482841 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g259550 | (1 of 2) PTHR23074//PTHR23074:SF20 - AAA ATPASE // GH08677P | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGACGATGAGACGGGTGCTGACAGTGATG |
| Internal bar code: | ACTGCGCCCTTCTCTCTGGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 99.4229 |
| LEAP-Seq n confirming: | 3101 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTACTACCGGAAACCTGCC |
| Suggested primer 2: | GGTACGCCTTTGCGTAATGT |