| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.212136 |
| Chromosome: | chromosome 7 |
| Location: | 279091 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314050 | (1 of 12) 2.7.11.18 - [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAAAATGCCCGCGGCAAGACACGCGCG |
| Internal bar code: | TTCCAACTTGCCGCGGTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 832 |
| LEAP-Seq percent confirming: | 98.9373 |
| LEAP-Seq n confirming: | 4562 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCCACCTGTGCCTTAGTG |
| Suggested primer 2: | TTATCGCTGCTAGGGTTGCT |