| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212304 |
| Chromosome: | chromosome 14 |
| Location: | 739887 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g612700 | FAP50,DRC7 | Nexin-dynein regulatory complex 7; (1 of 1) PF13415//PF13418//PF13855 - Galactose oxidase, central domain (Kelch_3) // Galactose oxidase, central domain (Kelch_4) // Leucine rich repeat (LRR_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCCTCCTCCCGCTCCCCCAAGCGCGGC |
| Internal bar code: | TCAGTCCGCAGAAGTTGACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 400 |
| LEAP-Seq percent confirming: | 99.7082 |
| LEAP-Seq n confirming: | 1025 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGGCTCAATGAACATC |
| Suggested primer 2: | GCAGCCGCTTACCAATCTAC |