| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.212312 |
| Chromosome: | chromosome 8 |
| Location: | 4893165 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384950 | (1 of 1) K14398 - cleavage and polyadenylation specificity factor subunit 6/7 (CPSF6_7) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAGCAGACGACGCCTGTCCTCGCGCTT |
| Internal bar code: | GGCAGCGACTTGCTCGCTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 99.7962 |
| LEAP-Seq n confirming: | 2449 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGATCTCGAGCTAAGTTG |
| Suggested primer 2: | ACTGCTGTTGTTGCTGTTGC |