| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.212327 |
| Chromosome: | chromosome 10 |
| Location: | 3998824 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448950 | EEP3 | Exonuclease-Endonuclease-Phosphatase superfamily protein; (1 of 1) K18764 - nocturnin [EC:3.1.13.4] (CCRN4L) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGAAAGAAACCGTGATCATGGCTGGTT |
| Internal bar code: | GCTGAGTGAGGACCGGAGTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 401 |
| LEAP-Seq percent confirming: | 98.8537 |
| LEAP-Seq n confirming: | 3622 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTCTTGCACAAGCCATA |
| Suggested primer 2: | TGCGAGCATGTGGAAGTAAG |