| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212363 |
| Chromosome: | chromosome 17 |
| Location: | 3995797 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728864 | OPR105 | (1 of 781) IPR000104 - Antifreeze protein, type I; OctotricoPeptide Repeat protein 105 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCCCCTCGGCACCTGACTCGTCATCCG |
| Internal bar code: | TGGTTTGGATATGTACGTCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 61 |
| LEAP-Seq percent confirming: | 98.8506 |
| LEAP-Seq n confirming: | 172 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCTCCAACGCTCACACAC |
| Suggested primer 2: | CTGCTGCTCTTCAGAAGCCT |