| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212423 |
| Chromosome: | chromosome 13 |
| Location: | 236004 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g563700 | FAP369 | Flagellar Associated Protein 369; (1 of 1) IPR001680//IPR011047//IPR017986//IPR027417 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACGAGGAGGAGGAGGAGGCGGGAGAGGG |
| Internal bar code: | AAACACAGCGAGTGGCAAATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 84.446 |
| LEAP-Seq n confirming: | 21744 |
| LEAP-Seq n nonconfirming: | 4005 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCATCTGACTCTCACGCA |
| Suggested primer 2: | CACATACGCACCTGGTTGTC |