Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.212449 |
Chromosome: | chromosome 2 |
Location: | 2231834 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g090000 | (1 of 8) PF00211//PF01547 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATTTGGGGAGTGGGGGTGTAGCCGTTC |
Internal bar code: | CGGGAGGGCGGGGAGCGGATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 540 |
LEAP-Seq percent confirming: | 87.2025 |
LEAP-Seq n confirming: | 2528 |
LEAP-Seq n nonconfirming: | 371 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCACTACCGTGTTGACAT |
Suggested primer 2: | TGTCCCTACTCCTTCCCCTT |