| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212559 |
| Chromosome: | chromosome 17 |
| Location: | 7111851 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g747397 | (1 of 1) PTHR24362//PTHR24362:SF284 - SERINE/THREONINE-PROTEIN KINASE NEK // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCACAACTGCACATGCCCGTTGCGAAGC |
| Internal bar code: | CTCGTTTTTTGTCAACGAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 73 |
| LEAP-Seq percent confirming: | 86.5291 |
| LEAP-Seq n confirming: | 713 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCGATCTAGCTGGTTTGG |
| Suggested primer 2: | TTATAAATGTAACCCGCGCC |