| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.212592 |
| Chromosome: | chromosome 3 |
| Location: | 5977683 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g190500 | RSW3,GLH1,GLC2A | (1 of 1) 3.2.1.84 - Glucan 1,3-alpha-glucosidase / Exo-1,3-alpha-glucanase; Glucosidase IIa | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCCATCAGTGGGCCGCTACCAGGTCCC |
| Internal bar code: | ATGAACAGGCCAGCCAGCAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 501 |
| LEAP-Seq percent confirming: | 91.2266 |
| LEAP-Seq n confirming: | 1071 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTAATTCACCGTGGCTTGC |
| Suggested primer 2: | CTTAGGCTTGGTGTCGGTGT |