Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.212594 |
Chromosome: | chromosome 1 |
Location: | 3468981 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g022000 | FIGN1,SPA1 | Putative fidgetin homolog; (1 of 1) PTHR23074//PTHR23074:SF17 - AAA ATPASE // FIDGETIN-LIKE PROTEIN 1 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGTCATCTTCATAGACGAGATAGACTC |
Internal bar code: | GGGGGGGATCGTAGGCTCCCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 763 |
LEAP-Seq percent confirming: | 97.9532 |
LEAP-Seq n confirming: | 335 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGTATGAGGAGGCTGAG |
Suggested primer 2: | GAATGTAGAGCTGCTTGGGC |