Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.212634 |
Chromosome: | chromosome 16 |
Location: | 2053351 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657150 | NAT35 | N-acetyltransferase; (1 of 1) PTHR23091:SF253 - GCN5-RELATED N-ACETYLTRANSFERASE | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTACGGCTGCGGTACGGCATACATTTCTT |
Internal bar code: | CCTAGCCCTCTTCCACCTCTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 451 |
LEAP-Seq percent confirming: | 86.9159 |
LEAP-Seq n confirming: | 93 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGTGACTGGGACTCAA |
Suggested primer 2: | AAAGGAACTGGTCGGTGTTG |