| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212690 |
| Chromosome: | chromosome 11 |
| Location: | 1031549 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467669 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATTCTAATGCCACAAAACACAAGAGGGC |
| Internal bar code: | AGGGATGACGTCAGATTCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 879 |
| LEAP-Seq percent confirming: | 99.6495 |
| LEAP-Seq n confirming: | 13932 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAATACAGGCGTGGACTC |
| Suggested primer 2: | CGAGATAACTTGCAGTGGCA |