| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212704 |
| Chromosome: | chromosome 10 |
| Location: | 1463550 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428664 | WD60,D1bIC1,FAP163,DIC6 | (1 of 2) PTHR12442//PTHR12442:SF26 - DYNEIN INTERMEDIATE CHAIN // WD REPEAT-CONTAINING PROTEIN 34; Dynein 1b Intermediate Chain IC1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTTGCGGGCTGGTACTGACAACTGAGC |
| Internal bar code: | TAGATTTGGTCCTTTACATGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 552 |
| LEAP-Seq percent confirming: | 99.6805 |
| LEAP-Seq n confirming: | 624 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGCTAGTTGAGCTTGGTT |
| Suggested primer 2: | GCCTTCTCTTTGCCATCTTG |