| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212720 |
| Chromosome: | chromosome 17 |
| Location: | 6657046 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g743897 | PRX7 | (1 of 3) K03386 - peroxiredoxin (alkyl hydroperoxide reductase subunit C) [EC:1.11.1.15] (E1.11.1.15, PRDX, ahpC); 2-cys Peroxiredoxin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAAAAGAGGGGGGGCTGCAAGGAGGG |
| Internal bar code: | GTCGGTGAGATTTGCAAGAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 99.2727 |
| LEAP-Seq n confirming: | 546 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTCTTAGCTCTGGTTGGG |
| Suggested primer 2: | AACGAGCAAAGCAAAGCAAT |