Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.212727 |
Chromosome: | chromosome 9 |
Location: | 6751604 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g409200 | SRS6,SRS12 | (1 of 2) K13172 - serine/arginine repetitive matrix protein 2 (SRRM2, SRM300); putative RNA-binding protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGCCCGTGCAAACACACGGGTCCAGGT |
Internal bar code: | ACTTGGGGTTCGGCGGGCTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 944 |
LEAP-Seq percent confirming: | 94.1877 |
LEAP-Seq n confirming: | 7438 |
LEAP-Seq n nonconfirming: | 459 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTCCTGCTTGATCTTCTC |
Suggested primer 2: | ACTTCTCGGCATGCCTCTTA |