| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.212727 |
| Chromosome: | chromosome 9 |
| Location: | 6751604 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g409200 | SRS6,SRS12 | (1 of 2) K13172 - serine/arginine repetitive matrix protein 2 (SRRM2, SRM300); putative RNA-binding protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCCCCACCCAACCCGCTTCTACCCCCAC |
| Internal bar code: | GGGCTGCTGCCGGTCATGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 807 |
| LEAP-Seq percent confirming: | 95.2311 |
| LEAP-Seq n confirming: | 3255 |
| LEAP-Seq n nonconfirming: | 163 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTCCTGCTTGATCTTCTC |
| Suggested primer 2: | ACTTCTCGGCATGCCTCTTA |