| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212758 |
| Chromosome: | chromosome 2 |
| Location: | 4741028 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g102276 | CDS | ||
| Cre02.g102300 | (1 of 1) PTHR31013 - THAUMATIN FAMILY PROTEIN-RELATED | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCCTCGAATCCATGTTGACGCACGTGT |
| Internal bar code: | AAGTAACCAAGACGCACGGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 657 |
| LEAP-Seq percent confirming: | 97.6048 |
| LEAP-Seq n confirming: | 163 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCGAGTGATGTACAGGC |
| Suggested primer 2: | GCTTACGGTACTGAGACGCC |