| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212785 |
| Chromosome: | chromosome 4 |
| Location: | 1379234 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214504 | (1 of 1) IPR000095//IPR001190//IPR008979//IPR017448 - CRIB domain // SRCR domain // Galactose-binding domain-like // SRCR-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTCGGGCACATCGCAAGCATTCTTGCA |
| Internal bar code: | GAACTCTGAATCCGGGCCCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 532 |
| LEAP-Seq percent confirming: | 99.6456 |
| LEAP-Seq n confirming: | 1687 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGCCCTGGGTTAGAG |
| Suggested primer 2: | GGTTACGGCAGGTAGATGGA |