| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.212799 |
| Chromosome: | chromosome 12 |
| Location: | 8294681 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549950 | (1 of 1) IPR007305//IPR011691//IPR020846 - Vesicle transport protein, Got1/SFT2-like // Vesicle transport protein, SFT2-like // Major facilitator superfamily domain; SFT2-like protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACAGAGAGCGAAACCAACCTCGCATATT |
| Internal bar code: | GGGCACCACTCTCGGCGGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 435 |
| LEAP-Seq percent confirming: | 99.689 |
| LEAP-Seq n confirming: | 1282 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGCTAGGAGACGTCAAGG |
| Suggested primer 2: | CGGTATAGCACTGACGAGCA |