Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.212803 |
Chromosome: | chromosome 10 |
Location: | 2968240 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440550 | (1 of 14) PF13540 - Regulator of chromosome condensation (RCC1) repeat (RCC1_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGATGGTGCTGGGGTTGAGAAATTGGCA |
Internal bar code: | GAATGACATTATACGCATGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 205 |
LEAP-Seq percent confirming: | 99.49 |
LEAP-Seq n confirming: | 3316 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTCTGCCTTATCGACAC |
Suggested primer 2: | GGTGGTATGGCAAGCTGTTT |