| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.212817 |
| Chromosome: | chromosome 9 |
| Location: | 3383926 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388801 | (1 of 1) IPR001615 - Delta-endotoxin CytB | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTTCACAGGAGAGCCGGACTGCGCTGAC |
| Internal bar code: | AAGTTCTAGGTGTCAAGGGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 764 |
| LEAP-Seq percent confirming: | 96.0061 |
| LEAP-Seq n confirming: | 8798 |
| LEAP-Seq n nonconfirming: | 366 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAGCAACCAACCTGAATC |
| Suggested primer 2: | AGGGTGTACTGTTTACGCGG |