| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212832 |
| Chromosome: | chromosome 15 |
| Location: | 663780 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g637761 | ABCD1 | Peroxisomal long-chain acyl-CoA transporter, ABC superfamily; (1 of 1) K05677 - ATP-binding cassette, subfamily D (ALD), member 3 (ABCD3, PMP70) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAGTTAGCGATGTACCATCATGTTTGG |
| Internal bar code: | TACGAAGATCTCGGATCGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 345 |
| LEAP-Seq percent confirming: | 93.3686 |
| LEAP-Seq n confirming: | 3703 |
| LEAP-Seq n nonconfirming: | 263 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTCGCCAAGTAGTAGTGG |
| Suggested primer 2: | CATCCATGGGATGGTGTGTA |