| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.212838 |
| Chromosome: | chromosome 3 |
| Location: | 2500795 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g159750 | VPS36 | Subunit of ESCRT-II complex; (1 of 1) K12190 - ESCRT-II complex subunit VPS36 (VPS36, EAP45) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGCGTGGGCCTGCTACGCAACCTGCTA |
| Internal bar code: | ATATGCCTGGGCTAATCCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 99.4837 |
| LEAP-Seq n confirming: | 578 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTGTGTCTGCAGGTTTA |
| Suggested primer 2: | ATGGGACAGTGGTAAGGCAG |