| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212855 |
| Chromosome: | chromosome 14 |
| Location: | 3515233 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630871 | ZCP1 | Zn chaperone; (1 of 2) PTHR13748//PTHR13748:SF44 - COBW-RELATED // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCTACGCCTCAAAGGGCTGCACGCCT |
| Internal bar code: | CGCGGACATCGAAACGACGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 882 |
| LEAP-Seq percent confirming: | 64.4388 |
| LEAP-Seq n confirming: | 1022 |
| LEAP-Seq n nonconfirming: | 564 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCTAGGGATGGCTGGGT |
| Suggested primer 2: | GGTGCTCAGTTTAGCAAGCC |