Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.212919 |
Chromosome: | chromosome 4 |
Location: | 1433306 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g214250 | AGO2 | Argonaute-like protein; (1 of 3) PTHR22891:SF0 - PROTEIN ARGONAUTE-2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCTTATGCGCAGAGGTGTTGTTGGTAT |
Internal bar code: | TTCGGGGGAAAAGGTGAGTCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 714 |
LEAP-Seq percent confirming: | 58.1955 |
LEAP-Seq n confirming: | 3483 |
LEAP-Seq n nonconfirming: | 2502 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGGAGTTCTACAGGGC |
Suggested primer 2: | GCTCTCACGCTCTACTCGCT |