| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.212946 |
| Chromosome: | chromosome 12 |
| Location: | 4938046 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525600 | (1 of 8) IPR001810//IPR006553 - F-box domain // Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGGCCGTAGTGGCGGTGGCCGTAGCGG |
| Internal bar code: | CGGAAGGTCAGAGTCTGTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 410 |
| LEAP-Seq percent confirming: | 84.6843 |
| LEAP-Seq n confirming: | 1797 |
| LEAP-Seq n nonconfirming: | 325 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTACACGCACATGAGAAC |
| Suggested primer 2: | CTCCAGCATCCCCATGAC |