| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213025 |
| Chromosome: | chromosome 12 |
| Location: | 8710873 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546050 | DXR,DXR1 | (1 of 1) 1.1.1.267 - 1-deoxy-D-xylulose-5-phosphate reductoisomerase / DXP-reductoisomerase; 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplast precursor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCACTCCGGTAGGCGAACGCGCACGGCC |
| Internal bar code: | CGATGATGTACCGCAGGGCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 99.8828 |
| LEAP-Seq n confirming: | 1705 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAAGCTCCACAGTATTCG |
| Suggested primer 2: | TCGCTGTGTTTCCATCACTC |