| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213151 |
| Chromosome: | chromosome 1 |
| Location: | 5531288 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039150 | PIC1,CPLD5,TIC21 | Conserved in the plant lineage and diatoms 5; (1 of 2) PTHR33510:SF5 - PROTEIN TIC 20-V, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAGCGTCAGTAGCGTCTCAGCTTGCAT |
| Internal bar code: | GTCGTACCTCGGGACCAGCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 899 |
| LEAP-Seq percent confirming: | 99.8436 |
| LEAP-Seq n confirming: | 6385 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGTCTGTGTGTCAGGCG |
| Suggested primer 2: | GGTCGCTACCTGTTCCACAT |